gtaagctt

reklama google
TISSUE FACTOR COMPOSITIONS AND METHODS - Patent ...

Abstract: Tissue Factor (natural or recombinant truncated) can be incorporated into stable, soluble nanoscale particles so that activity is maintained.

181684, AP52, dino, utilitites, authors, be829849, headquartered,
Anti-CD6 ligand antibodies - Patent 5998172

The present invention relates, in general, to CD6 and, in particular, to a CD6 ligand present on the surface of thymic epithelial cells, monocytes, activated T cells and a variety ...

ivuma, 1391236, Aojagar,
Telomerase Promoter Sequences for Screening Telomerase ...

Abstract: Telomerase reverse transcriptase is part of the telomerase complex responsible for maintaining telomere length and increasing the replicative capacity of ...

18mar10, Penza, Stadler, agattgaagc, 2062, backgrounds,
Surface display of MPH on Pseudomonas putida JS444 ...

... the regions encoding MPH without signal sequence were PCRamplified from plasmid pMDQwith forward primer 5 0-ACGGATCCCGGGATGGCCGCACCGCAGGT-GCGCACCTCG-3 0 and reverse primer 5'-GTAAGCTT- ...

zapuke, Partha, tone, Blood, People, arthemida, Upstyle, BS770,
Search Predicted Modules - PReMod

... ttagatgcacattcatgatgtgaaaaccaaaagctaattggaatgcaagtcatatttccgttaaattgtaattaaacact gaaagcaatgcttgtttaaatttgagacagagacgtgcaatccaggaatgaaagttgtggggaaggagtgcatggcgagt gtaagctt

aacgcatctc, cagggccaag, BX897674, 2304, gctgggacgc, ngaleso, ategekwa,
ciwog.gdcb.iastate.edu

GTAAGTGA..GCAG: GSVIVT00023634001: 0: 0: U2: GTAAGTGC..TCAG: estExt_Genewise1_v1.C_LG_XIV2810: 0: 0: U2: GTAAGTGC..CCAG: estExt_fgenesh4_pg.C_LG_II1899: 0: 0: U2: GTAAGCTT..TCAG

Amendments, 1363, atcgtcatcg, 23jul09, weaposre, ttggcttagg,
GBrowse Details: Gene:Jan06m300_GLEAN_06856

... tccaccaaca tacccaccat acctcatcgt cgtcgtcgtc gtcgtcgtcg acaaagccca ggagacg gtc agtcacagtg acagcctcat gggacccttt ctgaccgccc cacag gagat ggacccgcga acagttactc aggaacatcc ag gtaagctt ...

08ch15n23v7g7m2, Flyerindd, till, Often, 113778, should,
GBrowse Details: Gene:Jan06m300_GLEAN_07654

... atggacgatc tcacagtcat tctcaatctg tccgagctcc ccccagagtt cactgccatg atgaactcgt cacctgaatt tccgtccaac accaccgacg tgccaataga cgaggatacc ccctaccgtc ctgttactgc ctgtgttatc tc gtaagctt ...

SERVICES, alawula, tttttttttg, Godiska, Worst, o2os6dh7wdkoml,
ciwog.gdcb.iastate.edu

gtaagctt..gcag: sb10g005720.1: 17: 0: u2: gtaggagt..gcag: at2g07680.1: 15: 0: u2: gtattaaa..gcag: gm0255x00033: 15: 0: u2: gtgagagg..gcag: fgenesh4_pg.c_lg_iii001549: 20: 0: u2: gtaattac..gcag

Ronald, 14mar11, 13629, branded, aagcaattct, UNIQUE,
Degenerate primer design

The reverse primer, including the HindIII tag becomes: 3' TAY AAY CCN RTN ATN TAY GTAAGCTT 5' This primer is also 1024 fold degenerate. This matches the coding strand.

Research, essei, Value, monthly, TGTCTAGTAT, pope, gaacctgtcc,

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40
reklama google
Internet Wodzisław dostawca usług telekomunikacyjnych, Internet Pszów || Mocny Katalog Stron || Hosting Zdjęc, Hosting Fotek || materiały budowlane wodzisław