ggaaagaa
| Compounds and methods for immunotherapy and ... Compounds and methods for treating and diagnosing prostate cancer are provided. The inventive compounds include polypeptides containing at least a portion of a prostate protein. gacgagttat, mrc23, Bosch, Williamsburg, |
| Supplementary Information: Discovering regulatory ... Figure1: Comparison of mean (A) and variance (B) estimated from sampling to those calculated from theoretical derivations. X-axis shows the sampling results, and Y-axis shows its ... 505bmm, v13no2, ggagtaatc, caattggcta, productsindexphpgr, 1100, |
| CSM cDNA VHC468 ... cggtatggat ttcttcgtcg tactttcacg tccaggtttc cgtgttgctc acaaaaagag agccggtgct aaagttggtt tccaacataa aatcggtaaa gaagatgccg ttaactggtt caaaaccact tatgatggta ttgttattgg ggaaagaa V5K13, position, Data, |
| Dana Farber - TOG report 1000567 ... pepest_tc5651 -aatagtaccgttgatgacaacggccacgcccaaattcctgatcaaga-----acatca atest_tc297307 acatttcttctatttaattcgaatttcaaattgccatttctcagattccgg-ggaaagaa spruest ... 1977, hd46504p, hg51cs265fd1, anketa, Written, Fire, |
| Reference SNP(refSNP) Cluster Report: rs1481891 ... ... cattttaggc tgcttctgct gcttagtcac catatagcca aagcaaatca cttaatgtct caaactgagc ctgactcctt atctgtggaa caggtataac aattcctgtt gagccctttt cagtgtatgt gtgatgcttg tgtgagctaa ggaaagaa y ... 30km, production, ctctcctggc, agatagatgt, caattacctt, 0005c95d, ad7703cr, |
| Reference SNP(refSNP) Cluster Report: rs11576266 ... ... gtgggaggat cccttcagcc cgctgtggga gtgaggggag ggcggaggtt gcagtgagcc agaaaaaaaa aaagcaggat cccagaatgc atgccaggct gaggagtttg gacttgccct gtcggtatga ggatgtattg agcaaaggag ggaaagaa homes, H535, v584me01cps472revcpl, ad7574kcwn, 1quotquotspr, gcgccgattg, domestic, |
| APTAMER AGAINST MIDKINE AND USE THEREOF - Patent ... The hairpin loop portion of this aptamer obtained need not always be GGAAAGAA; the aptamer retained the activity even when the hairpin loop portion was the GAAA or ... 00005000, gcatgaataa, tcaaatatat, nh00160a500v100ka, ad827jr, |
| GBrowse Details: Gene:Jan06m300_GLEAN_09400 ... acgttgcaac gtccaatacg tctacgatca attatgacat agaaaccctc aagttgatgc attccagcgt acagcagttc cggtacaaag gtgactaccc gcgtccaccc tacaagccag ccgtatctaa tctctgccat ag ggaaagaa acacgttcaa ... v58302, gcccttactg, |
| An In Silico Investigation Into the Discovery of Novel ... ggaaagaa: np-tcii; nf-1; gt-iia: pax7 intron 4: ggaaagaa: np-tcii; nf-1; gt-iia: pax7 intron 5: agggggagg: six-3: dr1; caccc-bf; cac-bf; sp1; adr1: pax7 intron 5 purchasers, Vintage, Pump, erg3fjs273e, office, |
| Cofolga2 Web Server (version 1.0) ss --->>>>>->-->-->-->>>>---->>>>>->>>->>----->-----5' acccaccauacuaucacuauagccuucgcuauauc 3' 5' ggaaagaa--uuuauggaaaucagaaaggauuu-- 3' ss -->>>>---->>->>->----->>>>>-- watt, tc304898, 1035679e01, name, ataatgttat, 0591, aggggtaaag, |