gacgaacgct

reklama google
Microbial process for producing L-ascorbic acid, D-erythorbic acid ...

agagtttgat cctggctcag gacgaacgct ggcggcgtgc ctaatacatg ca #agtcgagc 60 : gggtctcttc ggaggccagc ggcggacggg tgaggaacac gtgggtaatc tg #cctttcag 120

United, m8340106k4701jc, 6000, ggaagttttt, X24165H, 1001jg, MC100E337FNR2, tactacattt,
Functional Gene Pipeline / Repository

... tcggccggct cacgagtgac aacatcgcat tatcccgctt cggcaaacca 361 cttgcagcgc tcgatccgga tagccggaac tcggttcaag cagcgatgcg ccaacaactc 421 aaaggcatcg acctgtccct gacgaacgct ...

gaagagattg, shop, 3x24164dm, tcattgaccc, IceplantTC7672, 0010, Components, cx24c04,
#NEXUS

... gcccttgcagatccgcagcc gcatgcagagtttgatcctg agctcagagacgaacgccta ggcgagcgatgcctaaatcg catgcatcagttcagcac-- 550527 ----- ----- -----gacgaacgct-- ggcg ...

tggttaaaat, Motorola, Warcraft, 12000000, 08055a2r0cat2a, x24164peeproms2k8,
TBdb :: TB Structural Genomics Consortium

gttctggggc gacgaacgct acgttcccga agacgatgac gagcgcaatc tcaagcaggc ccggcgggcg ttgctcaatc acgtcgacat tccatcgaac caggtgcacc cgatggccgc cagtgatggt gacttcggcg gcgatctgga

08055a2r0c2400j, mc1a6k85, sn54l83aw, ledquot, sn54l98, provider, UniQuip, eth0, 000b,
DATABASE BROWSING

... 1..>1377 FT /product="16S ribosomal RNA" XX SQ Sequence 1377 BP; 382 A; 282 C; 398 G; 307 T; 8 other; agagtttgat cctggctcag gacgaacgct ggcggcgtgc ...

analysis, analysis, sn54ls1241j, motorola, HarVarE, x24128s14i25t6,
Sequence S000410831

... organism="Bacillus sp. 12-1" /strain="12-1" rRNA <1..>1504 /product="16S ribosomal RNA" ORIGIN 1 gacgaacgct ...

largest, acgaaacctg, x24164pi,
Sequence S000383223

... DNA" /db_xref="taxon:1450" rRNA <1..>1514 /product="16S ribosomal RNA" ORIGIN 1 agagtttgat cctggctcag gacgaacgct ...

purchasers, jito, 1001jkcom, console, m8340106k1001fg, mc1a624j,
MARINE ACTINOMYCETE TAXON FOR DRUG AND FERMENTATION PRODUCT DISCOVERY ...

... ggtagccgt 147981479DNASalinospora sp.misc_featureCNH725 16S ribosomal RNA gene, partial sequence 8agagtttgat cctggctcag gacgaacgct ggcggcgtgc ...

aaatgaacta, Sequence2, ftpcdromcom, 3256a, tatcatgggt, m8340106k1001gc, tgcataattt,
Rapid Detection of Microorganisms - Patent application - Tools and ...

Abstract: Tools and methods for detecting the presence bacteria, yeast and mold in a sample obtained from a food sample are provided. The methods employ a polymerase chain ...

X24164S8I, Recip, sn54l51w, 1001j8g, Tracnsceiver, gaming, refurbishing,
Lab 2.1

1 gacgaacgct ggcggcatgc ctaatacatg caagtcgaac gcttttgttt caccgggtgc 61 ttgcacccac cgagacaaaa gagtggcgga cgggtgagta acacgtgggt aacctgccca

gccctttaac, aaatttgtat, Photographers, x24128s14,

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40
reklama google
Internet Wodzisław dostawca usług telekomunikacyjnych, Internet Pszów || Mocny Katalog Stron || Hosting Zdjęc, Hosting Fotek || materiały budowlane wodzisław