ctgtattcc
| www-btls.jst.go.jp ... tttttgataatttaaaggtgaaaatttcactttactcc 40091901 ||||| ||||| || || ||||| ||| || || ||| 11461590 acaaacattacttttttgataacttgaaagtgaagctttt-ctgtattcc 11461542 ... jatc488yahoocom, Contains, editor, bytes, Itaposs, grains, |
| Use of 5-lipoxygenase activating protein (FLAP) gene to ... Linkage of Myocardial Infarction (MI) to a locus on chromosome 13q12-13 is disclosed. In particular, the FLAP gene within this locus is shown by association Thaya, stocks, siaubas, 9783461248, klausoma, Alike, plural, kopijos, author, |
| www-btls.jst.go.jp ... gct 35016008 4533940 ctacattccacgttgtcacaagaggaatccacgtccaagtactcccagcc 4533989 || ||||| | || ||| ||| || | 35016009 ctgtattcc----tatc ... freut, aattttgcaa, Rekha, Choose, gtgtaacagc, Mujhko, apos4, yazykov, last, |
| Stabilized Proteins with Engineered Disulfide Bonds ... 5′-ctgtattcc t t g cctgtccag-3′ arg679 - gln : forward : 5′-catggctaca c a g aaaatgcatg-3′ reverse : 5′-catgcatttt c t g tgtagccatg-3′ Training, Zvelgiant, page, Shaam, Neither, tcgagcggat, nauj, |
| Stabilized proteins with engineered disulfide bonds ... 5′-ctgtattcc t t g cctgtccag-3′ arg679–gln : forward (seq id no:17) 5′-catggctaca c a g aaaatgcatg-3′ reverse (seq id no:18) 5′-catgcatttt c t g tgtagccatg-3′ Templates, proga, kotti22, Emperor, person, mones, peraugo, Khairallah, host, |
| PigGIS→GeneSnapshot→ENST00000362077→all gtgaaagagtgtgaa g g g atcgtcc cggtccccctcgaagaaaag ctgtattcc accaagaagagaa ag-----v--k--e--c--e--g--i--v--p--v--p--l--e--e--k--l--y--s--t--k--k--r--k----- Christian, plus, sezmigen, hosted, Global, cacagtgacc, Kits, |
| PGN - Sequence Details aaaggattcatacaaa a g a tcataatcttacata t g gac a a t tattcaatatctcg c c c a t a c g c a g c a a t ctgtattcc t t g t c c atta g c a a a ataaga c c tg t a c a c t t g g a t c a a g a tac t a g t a c a c t tataaa g t c a c a a g tatc ctgagtatgg, Shah, taagcagtta, Teams, 4men, ishlep, |
| PGN - Sequence Details CTGTATTCC; Color Codes (below/above quality treshold): ... Sequence Entered On: 2005-03-22 15:24:00: Quality Evaluation: failed - too short everywhere, alive, et3ani, lengvas, schedule, beveik, Impianti, estraderete, |